5-Aza inhibits cell migration and methylation of CDH1 gene in tongue squamous cell carcinomacell lines

doi:10.3877/cma.j.issn.1674-1366.2016.03.001

Abstract

Abstract:

Objective

To evaluate the effect of 5-Aza on methylation of CDH1 and the migration and mobility of tongue squamous cell carcinoma (TSCC) cell lines.

Methods

Two TSCC cell lines UM1, UM2 were treated with or without 5-Aza. Cell morphology and growth patterns were observed under the light microscope. Wound healing and transwell assay were performed to determine the ability of cell migration. Western blot and immunofluorescence were used to detect the expression of E-cadherin. Methylation specific polymerase chain reaction (MSP) was used to determine the methylated profile of CDH1. Chi-square test was performed to compare relative invasion rate and the significance level was set at P<0.05.

Results

UM1 cells appeared to be dispersed, spindle-shaped with migratory protrusions, whereas, UM2 cells presented with cobblestone-like pattern and an apical-basal polarity. A higher expression of E-cadherin with lower mobility was demonstrated in UM2 than in UM1. The wound area was completely covered in UM1 after 48 h, while less than 75% in UM2. UM1 displayed a higher methylation profile in the MSP detection. After treated with 5-Aza in UM1 cells, the cell morphology became irregular and UM2-like with firm cell connection. The 48 h wound cover area of 5-Aza treated UM1 was less than 70%, the relative invasion rate was 102% (χ² = 0.651, P>0.05) compared to the untreated cells and E-cadherin expression was increased, while a demethylation of CDH1 gene was observed.

Conclusion

Demethylation of CDH1 was involved in 5-Aza mediated inhibition of cell migration and motility in TSCC cells.

Key words: Tongue, Carcinoma, squamous cell, Migration, Methylation, E-cadherin, Epithelial-mesenchymal transition

Weixin Cai, Cheng Wang, Huibin Ma, Jinsong Hou, Xiqiang Liu, Xiaohua Chen, Hongzhang Huang. 5-Aza inhibits cell migration and methylation of CDH1 gene in tongue squamous cell carcinomacell lines[J]. Chinese Journal of Stomatological Research(Electronic Edition), 2016, 10(03): 155-160.

/ / Recommend

Add to citation manager EndNote|Ris|BibTeX

URL: https://zhkqyxyjzz.cma-cmc.com.cn/EN/10.3877/cma.j.issn.1674-1366.2016.03.001

https://zhkqyxyjzz.cma-cmc.com.cn/EN/Y2016/V10/I03/155

Figures/Tables 5

References 16

[1]	Hugo H, Ackland ML, Blick T，et al. Epithelial-mesenchymal and mesenchymal-epithelial transitions in carcinoma progression[J]. J Cell Physiol，2007，213(2):374-383.
[2]	Yang J, Weinberg RA. Epithelial-mesenchymal transition：at the crossroads of development and tumor metastasis[J]. Dev Cell，2008，14(6):818-829.
[3]	Rodriguez FJ, Lewis-Tuffin LJ, Anastasiadis PZ. E-cadherin′s dark side：possible role in tumor progression[J]. Biochim Biophys Acta，2012，1826(1):23-31.
[4]	Kudo Y, Kitajima S, Ogawa I，et al. Invasion and metastasis of oral cancer cells require methylation of E-cadherin and/or degradation of membraneous beta-catenin[J]. Clin Cancer Res，2004，10(16):5455-5463.
[5]	Wang C, Liu X, Chen Z，et al. Polycomb group protein EZH2-mediated E-cadherin repression promotes metastasis of oral tongue squamous cell carcinoma[J]. Mol Carcinog，2013，52(3):229-236.
[6]	Wang C, Liu X, Huang HZ，et al. Deregulation of Snai2 is associated with metastasis and poor prognosis in tongue squmous cell carcinoma[J]. Int J Cancer，2012，130(10):2249-2258.
[7]	Acloque H, Adams MS, Fishwick K，et al. Epithelial-mesenchymal transitions：theimportance of changing cell state in development and disease[J]. J Clin Invest，2009，119(6):1438-1449.
[8]	Yan C, Grimm WA, Garner WL，et al. Epithelial to mesenchymal transition in human skin wound healing is induced by tumor necrosis factor-alpha through bone morphogenic protein-2[J]. Am J Pathol，2010，176(5):2247-2258.
[9]	López-Novoa JM, Nieto MA. Inflammation and EMT：an alliance towards organ fibrosis and cancer progression[J]. EMBO Mol Med，2009，1(6-7):303-314.
[10]	Chaffer CL, Brennan JP, Slavin JL，et al. Mesenchymal-to-epithelial transition facilitates bladder cancer metastasis：role of fibroblast growth factor receptor-2[J]. Cancer Res，2006，66(23):11271-11278.
[11]	Lee TK, Man K, Poon RT，et al. Signal transducers and activators of transcription 5b activation enhances hepatocellular carcinoma aggressiveness through induction of epithelial-mesenchymal transition[J]. Cancer Res，2006，66(20):9948-9956.
[12]	Alonso SR, Tracey L, Ortiz P，et al. A high-throughput study in melanoma identifies epithelial-mesenchymal transition as a major determinant of metastasis[J]. Cancer Res，2007，67(7):3450-3460.
[13]	Zhong LP, Li J, Zhang CP，et al. Expression of E-cadhefin in cervical lymph nodes from primary oral squamous cell carcinoma patients[J]. Arch Oral Biol，2007，52(8):740-747.
[14]	Wang C, Huang H, Huang Z，et al. Tumor budding correlates with poor prognosis and epithelial-mesenchymal transition in tongue squamous cell carcinoma[J]. J Oral Pathol Med，2011，40(7):545-551.
[15]	Nakayama S, Sasaki A, Mese H，et al. Establishment of high and low metastasis cell lines derived from a human tongue squamous cell carcinoma[J]. Invasion Metastasis，1998-1999,18(5-6):219-228.
[16]	Park YJ, Claus R, Weichenhan D，et al. Genome-wide epigenetic modifications in cancer[J]. Prog Drug Res，2011(67):25-49.

基因	引物序列	扩增片段长度 (bp)
CDH1?M	F:5′?TTAGGTTAGAGGGTTATCGCGT?3′	97
?	R:5′?TAACTAAAAATTCACCTACCGAC?3′	?
CDH1?U	F:5′?TAATTTTAGGTTAGAGGGTTATTGT?3′	237
?	R:5′?CACAACCAATCAACAACACA?3′	?

基因	引物序列	扩增片段长度 (bp)
CDH1?M	F:5′?TTAGGTTAGAGGGTTATCGCGT?3′	97
?	R:5′?TAACTAAAAATTCACCTACCGAC?3′	?
CDH1?U	F:5′?TAATTTTAGGTTAGAGGGTTATTGT?3′	237
?	R:5′?CACAACCAATCAACAACACA?3′	?

Please choose a citation manager

Content to export