Effects of estrogen on the stemness maintenance of human periodontal ligament stem cells

doi:10.3877/cma.j.issn.1674-1366.2016.02.005

Abstract

Abstract:

Objective

To investigate the biological effect of estrogen (E₂) on the stemness maintenance of human periodontal ligament stem cells (hPDLSCs) .

Methods

Primary hPDLSCs were isolated and characterized. After treatment with estrogen for 48 h, flow cytometry was used to evaluate cell cycle. The changes in human telomerase reverse transcriptase (hTERT) genes, stemness related genes Oct4, Sox2, c-Myc, aging related genes p16 and p53 were detected by q-PCR. After long-term culture with estrogen, colony formation ability and osteogenic differentiation potential were evaluated. The mean values between groups were analyzed by Paired-Samples T Test in SPSS 17.0. A significance level was set at 0.05.

Results

We isolated hPDLSCs and confirmed their capacity as mesenchymal stem cells. Proliferation ability of hPDLSCs was increased under 48 hours estrogen treatment (t= 9.913, P= 0.010) . q-PCR results showed that the expression level of hTERT (1.958 ± 0.338) was higher than the control group (1.000 ± 0.018) , there was a statistically significant difference between the groups (t= 7.00, P= 0.001) ; the expression level of Oct4 (2.539 ± 0.493) was higher than the control group (1.000 ± 0.011) , there was a statistically significant difference between the groups (t= 6.26, P= 0.001) ; the expression level of Sox2 (2.234 ± 0.255) was higher than the control group (1.016 ± 0.221) , there was a statistically significant difference between the groups (t= 6.26, P= 0.003) ; the expression level of c-Myc (1.328 ± 0.091) was higher than the control group (1.003 ± 0.088) , there was a statistically significant difference between the groups (t= 5.67, P= 0.002) , while senescence related genes that the expression level of p16 (0.460 ± 0.085) was lower than the control group (1.009 ± 0.163) , there was a statistically significant difference between the groups (t= 12.24, P= 0.007) and the expression level of p53 (0.301 ± 0.041) was lower than the control group (1.004 ± 0.115) , there was a statistically significant difference between the groups (t= 7.77, P= 0.016) . After long-term culture, the ability of clone formation (0.058 ± 0.008) was stronger than that of the NC group (0.013 ± 0.008) , there was a statistically significant difference between the groups (t= 5.60, P= 0.028) . And the osteogenic ability (A_NC= 1.238 ± 0.084; A_E2= 2.460 ± 0.182, t= 16.41, P<0.001) of hPDLSCs with estrogen treatment was significantly stronger than that of the NC group.

Conclusions

Estrogen can increase the expression of hTERT and Oct4, Sox2, c-Myc genes, maintain cell proliferation and inhibit cell senescence. Estrogen also can maintain stemness of hPDLSCs in long-term culture in vitro.

Key words: Estrogen, Human periodontal ligament stem cells, Stemness, Human telomerase reverse transcriptase

Xubin Dai, Xiaoxiao Wang, Fanqiao Yang, Qianmin Ou, Siqi Yao, Yan Wang, Xuefeng Lin. Effects of estrogen on the stemness maintenance of human periodontal ligament stem cells[J]. Chinese Journal of Stomatological Research(Electronic Edition), 2016, 10(02): 104-111.

/ / Recommend

Add to citation manager EndNote|Ris|BibTeX

URL: https://zhkqyxyjzz.cma-cmc.com.cn/EN/10.3877/cma.j.issn.1674-1366.2016.02.005

https://zhkqyxyjzz.cma-cmc.com.cn/EN/Y2016/V10/I02/104

Figures/Tables 8

References 31

[1]	Chen FM, Sun HH, Lu H，et al. Stem cell-delivery therapeutics for periodontal tissue regeneration[J]. Biomaterials，2012，33(27):6320-6344.
[2]	Hynes K, Menicanin D, Gronthos S，et al. Clinical utility of stem cells for periodontal regeneration[J]. Periodontol 2000，2012,59(1):203-227.
[3]	Zhu W, Liang M. Periodontal ligament stem cells：current status，concerns，and future prospects[J/OL]. Stem Cells Int，2015[2015-03-16]. published online ahead of print March 23，2016]. URL
[4]	Wada N, Menicanin D, Shi S，et al. Immunomodulatory properties of human periodontal ligament stem cells[J]. J Cell Physiol，2009，219(3):667-676.
[5]	Otte A, Bucan V, Reimers K，et al. Mesenchymal stem cells maintain long-term in vitro stemness during explant culture[J]. Tissue Eng Part C Methods，2013，19(12):937-948.
[6]	Cheng H, Qiu L, Ma J，et al. Replicative senescence of human bone marrow and umbilical cord derived mesenchymal stem cells and their differentiation to adipocytes and osteoblasts[J]. Mol Biol Rep，2011，38(8):5161-5168.
[7]	Hong L, Zhang G, Sultana H，et al. The effects of 17-β estradiol on enhancing proliferation of human bone marrow mesenchymal stromal cells in vitro[J]. Stem Cells Dev，2011，20(5):925-931.
[8]	Cha Y, Kwon SJ, Seol W，et al. Estrogen receptor-alpha mediates the effects of estradiol on telomerase activity in human mesenchymal stem cells[J]. Mol Cells，2008，26(5):454-458.
[9]	Kim BC, Bae H, Kwon IK，et al. Osteoblastic/cementoblastic and neural differentiation of dental stem cells and their applications to tissue engineering and regenerative medicine[J]. Tissue Eng Part B Rev，2012，18(3):235-244.
[10]	Yeasmin S, Ceccarelli J, Vigen M，et al. Stem cells derived from tooth periodontal ligament enhance functional angiogenesis by endothelial cells[J]. Tissue Eng Part A，2014，20(7-8):1188-1196.
[11]	Wu Y, Yang Y, Yang P，et al. The osteogenic differentiation of PDLSCs is mediated through MEK/ERK and p38 MAPK signalling under hypoxia[J]. Arch Oral Biol，2013，58(10):1357-1368.
[12]	Ding G, Liu Y, Wang W，et al. Allogeneic periodontal ligament stem cell therapy for periodontitis in swine[J]. Stem Cells，2010，28(10):1829-1838.
[13]	Mrozik KM, Wada N, Marino V，et al. Regeneration of periodontal tissues using allogeneic periodontal ligament stem cells in an ovine model[J]. Regen Med，2013，8(6):711-723.
[14]	Dominici M, Le Blanc K, Mueller I，et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement[J]. Cytotherapy，2006，8(4):315-317.
[15]	Asselin-Labat ML, Vaillant F, Sheridan JM，et al. Control of mammary stem cell function by steroid hormone signalling[J]. Nature，2010，465(7299):798-802.
[16]	Sun H, Wang H, Hu S. Effects of estrogen on diverse stem cells and relevant intracellular mechanisms[J]. Sci China Life Sci，2010，53(5):542-547.
[17]	Liang L, Yu J, Wang Y，et al. Effect of estrogen receptor beta on the osteoblastic differentiation function of human periodontal ligament cells[J]. Arch Oral Biol，2008，53(6):553-557.
[18]	Pan F, Zhang R, Wang G，et al. Oestrogen receptors are involved in the osteogenic differentiation of periodontal ligament stem cells[J]. Biosci Rep，2011，31(2):117-124.
[19]	Cha Y, Kwon SJ, Seol W，et al. Estrogen receptor-alpha mediates the effects of estradiol on telomerase activity in human mesenchymal stem cells[J]. Mol Cells，2008，26(5):454-458.
[20]	Zhang B, Li Y, Zhou Q，et al. Estrogen deficiency leads to impaired osteogenic differentiation of periodontal ligament stem cells in rats[J]. Tohoku J Exp Med，2011，223(3):177-186.
[21]	Cai C, Yuan GJ, Huang Y，et al. Estrogen-related receptor α is involved in the osteogenic differentiation of mesenchymal stem cells isolated from human periodontal ligaments[J]. Int J Mol Med，2013，31(5):1195-1201.
[22]	Bayne S, Jones ME, Li H，et al. Estrogen deficiency leads to telomerase inhibition，telomere shortening and reduced cell proliferation in the adrenal gland of mice[J]. Cell Res，2008，18(11):1141-1150.
[23]	Estrada JC, Torres Y, Benguría A，et al. Human mesenchymal stem cell-replicative senescence and oxidative stress are closely linked to aneuploidy[J]. Cell Death Dis，2013(4):e691.
[24]	Piper SL, Wang M, Yamamoto A，et al. Inducible immortality in hTERT-human mesenchymal stem cells[J]. J Orthop Res，2012，30(12):1879-1885.
[25]	Kyo S, Takakura M, Kanaya T，et al. Estrogen activates telomerase[J]. Cancer Res，1999，59(23):5917-5921.
[26]	Zhou C, Steplowski TA, Dickens HK，et al. Estrogen induction of telomerase activity through regulation of the mitogen-activated protein kinase（MAPK）dependent pathway in human endometrial cancer cells[J]. PLoS One，2013，8(2):e55730.
[27]	Fafián-Labora J, Fernández-Pernas P, Fuentes I，et al. Influence of age on rat bone-marrow mesenchymal stem cells potential[J/OL]. Sci Rep，2015[2015-11-19]. published online ahead of print March 23，2016]. URL
[28]	Chen X, Xu H, Yuan P，et al. Integration of external signaling pathways with the core transcriptional network in embryonic stem cells[J]. Cell，2008，133(6):1106-1117.
[29]	Takahashi K, Tanabe K, Ohnuki M，et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors[J]. Cell，2007，131(5):861-872.
[30]	Jung EM, Choi KC, Yu FH，et al. Effects of 17beta-estradiol and xenoestrogens on mouse embryonic stem cells[J]. Toxicol In Vitro，2010，24(6):1538-1545.
[31]	Xie Y, Zhao X, Jia H，et al. Derivation and characterization of goat fetal fibroblast cells induced with human telomerase reverse transcriptase[J]. In Vitro Cell Dev Biol Anim，2013，49(1):8-14.

基因	引物序列	产物长度(bp)	基因库登记号
hTert	F:5′?TCTGGGATGCGAACGGGC?3′	153	NM_001193376.1
?	R:5′?TCCGGCTCAGGGGCAGC?3′	?	?
Oct4	F:5′?GGGCTCTCCCATGCATTCAAAC?3′	196	NM_002701
?	R:5′?CACCTTCCCTCCAACCAGTTGC?3′	?	?
Sox2	F:5′?GTGAGCGCCCTGCAGTACAA?3′	82	NM_003106.3
?	R:5′?GCGAGTAGGACATGCTGTAGGTG?3′	?	?
c?Myc	F:5′?AATGAAAAGGCCCCCAAGGTAGTTATCC?3′	112	NM_002467
?	R:5′?GTCGTTTCCGCAACAAGTCCTCTTC?3′	?	?
p16	F:5′?ATGGAGCCTTCGGCTGACT?3′	108	NM_000077.4
?	R:5′?GTAACTATTCGGTGCGTTGGG?3′	?	?
p53	F:5′?CAGCACATGACGGAGGTTGT?3′	125	NM_000546.5
?	R:5′?TCATCCAAATACTCCACACGC?3′	?	?
GAPDH	F:5′?AGCCACATCGCTCAGACAC?3′	67	NM_001289746.1
?	R:5′?GCCCAATACGACCAAATCC?3′	?	?

基因	引物序列	产物长度(bp)	基因库登记号
hTert	F:5′?TCTGGGATGCGAACGGGC?3′	153	NM_001193376.1
?	R:5′?TCCGGCTCAGGGGCAGC?3′	?	?
Oct4	F:5′?GGGCTCTCCCATGCATTCAAAC?3′	196	NM_002701
?	R:5′?CACCTTCCCTCCAACCAGTTGC?3′	?	?
Sox2	F:5′?GTGAGCGCCCTGCAGTACAA?3′	82	NM_003106.3
?	R:5′?GCGAGTAGGACATGCTGTAGGTG?3′	?	?
c?Myc	F:5′?AATGAAAAGGCCCCCAAGGTAGTTATCC?3′	112	NM_002467
?	R:5′?GTCGTTTCCGCAACAAGTCCTCTTC?3′	?	?
p16	F:5′?ATGGAGCCTTCGGCTGACT?3′	108	NM_000077.4
?	R:5′?GTAACTATTCGGTGCGTTGGG?3′	?	?
p53	F:5′?CAGCACATGACGGAGGTTGT?3′	125	NM_000546.5
?	R:5′?TCATCCAAATACTCCACACGC?3′	?	?
GAPDH	F:5′?AGCCACATCGCTCAGACAC?3′	67	NM_001289746.1
?	R:5′?GCCCAATACGACCAAATCC?3′	?	?

Please choose a citation manager

Content to export